ID: 952110382_952110387

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 952110382 952110387
Species Human (GRCh38) Human (GRCh38)
Location 3:30116633-30116655 3:30116678-30116700
Sequence CCTCTCAAAATCCCAGCAAGACT CATTGTAAGATATATATGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 15, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!