ID: 952122804_952122807

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 952122804 952122807
Species Human (GRCh38) Human (GRCh38)
Location 3:30264620-30264642 3:30264638-30264660
Sequence CCCAGATCTTTCCTCTGACACAG CACAGTCTACCCAAATGAGAAGG
Strand - +
Off-target summary No data {0: 15, 1: 173, 2: 567, 3: 455, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!