ID: 952150963_952150966

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 952150963 952150966
Species Human (GRCh38) Human (GRCh38)
Location 3:30591223-30591245 3:30591256-30591278
Sequence CCAGCTTCAGTAAATGAACTGGA TCCTTTTCTATTTTCCAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 76, 4: 750}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!