ID: 952150967_952150969

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 952150967 952150969
Species Human (GRCh38) Human (GRCh38)
Location 3:30591257-30591279 3:30591271-30591293
Sequence CCTTTTCTATTTTCCAGAATGGA CAGAATGGAGTGCATAGAATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!