ID: 952248408_952248415

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 952248408 952248415
Species Human (GRCh38) Human (GRCh38)
Location 3:31623816-31623838 3:31623856-31623878
Sequence CCTACTCTAGTCCAAGTGTAGTC TGATGGGTAAGAAAATAACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 73} {0: 1, 1: 0, 2: 3, 3: 22, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!