ID: 952273995_952274004

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 952273995 952274004
Species Human (GRCh38) Human (GRCh38)
Location 3:31859614-31859636 3:31859659-31859681
Sequence CCATGGGATGCCACAGCAAGAAG TCAATCTTGGACTTCCATCAAGG
Strand - +
Off-target summary {0: 2, 1: 72, 2: 233, 3: 1047, 4: 2337} {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!