ID: 952278066_952278075

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 952278066 952278075
Species Human (GRCh38) Human (GRCh38)
Location 3:31896782-31896804 3:31896814-31896836
Sequence CCCTACTCAGCACCTTTCCACAG GGCAGAGTTAGCAAAGCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 232} {0: 1, 1: 0, 2: 2, 3: 10, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!