ID: 952324911_952324920

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 952324911 952324920
Species Human (GRCh38) Human (GRCh38)
Location 3:32312487-32312509 3:32312524-32312546
Sequence CCCAGGGCAAGGCATGTGGGCAG AGCTGTGTCCCCATGGAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 48, 4: 359} {0: 1, 1: 0, 2: 2, 3: 33, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!