ID: 952334279_952334283

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 952334279 952334283
Species Human (GRCh38) Human (GRCh38)
Location 3:32391728-32391750 3:32391741-32391763
Sequence CCGGCCGGCCAGTCACCGGAGGG CACCGGAGGGATCCCGCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98} {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!