ID: 952336178_952336184

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 952336178 952336184
Species Human (GRCh38) Human (GRCh38)
Location 3:32404953-32404975 3:32404983-32405005
Sequence CCTGCTGGCTCTGAAGAAGTGAA GTTGAGAGAGGGCCTGTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 279} {0: 1, 1: 1, 2: 1, 3: 26, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!