ID: 952342563_952342568

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 952342563 952342568
Species Human (GRCh38) Human (GRCh38)
Location 3:32458145-32458167 3:32458160-32458182
Sequence CCTGCTGCCCCAGGGAGGAGCAG AGGAGCAGCTGCGGAAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 84, 4: 544} {0: 1, 1: 0, 2: 1, 3: 21, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!