|
Left Crispr |
Right Crispr |
| Crispr ID |
952373974 |
952373985 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:32749862-32749884
|
3:32749892-32749914
|
| Sequence |
CCTGTTCCCCCACATACCTATGG |
ATGAAGGAAGGAAGGAAAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 22, 3: 80, 4: 375} |
{0: 4, 1: 235, 2: 4319, 3: 47137, 4: 43150} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|