ID: 952406363_952406370

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 952406363 952406370
Species Human (GRCh38) Human (GRCh38)
Location 3:33008607-33008629 3:33008637-33008659
Sequence CCAAGGACTGCTGGGCAAATCTG CTGGAGGCTGGCAACAATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 171} {0: 1, 1: 0, 2: 1, 3: 15, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!