|
Left Crispr |
Right Crispr |
| Crispr ID |
952420229 |
952420234 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:33123720-33123742
|
3:33123768-33123790
|
| Sequence |
CCTAGGTTCAAGTGATTCTTGTG |
TACAAGCATGTGACTACACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 816, 1: 5243, 2: 36132, 3: 104883, 4: 155356} |
{0: 1, 1: 0, 2: 6, 3: 30, 4: 194} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|