ID: 952420233_952420234

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 952420233 952420234
Species Human (GRCh38) Human (GRCh38)
Location 3:33123749-33123771 3:33123768-33123790
Sequence CCTCGTGAGTAGCTGGGACTACA TACAAGCATGTGACTACACCTGG
Strand - +
Off-target summary {0: 133, 1: 43740, 2: 165943, 3: 225873, 4: 208175} {0: 1, 1: 0, 2: 6, 3: 30, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!