ID: 952447214_952447224

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 952447214 952447224
Species Human (GRCh38) Human (GRCh38)
Location 3:33393062-33393084 3:33393078-33393100
Sequence CCCCAGTGATTGGCTGCATCCTA CATCCTAAAGGGCTGGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136} {0: 1, 1: 0, 2: 1, 3: 27, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!