ID: 952467876_952467883

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 952467876 952467883
Species Human (GRCh38) Human (GRCh38)
Location 3:33610351-33610373 3:33610382-33610404
Sequence CCACCTTCTTTTCCCACTGAAAC TATCATATGTTCTGGCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 414} {0: 1, 1: 0, 2: 0, 3: 16, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!