ID: 952488838_952488840

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 952488838 952488840
Species Human (GRCh38) Human (GRCh38)
Location 3:33845572-33845594 3:33845590-33845612
Sequence CCATGCAGGGCAGTGAGGTAAGA TAAGAAGGACACTTTGATGTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 21, 4: 231} {0: 1, 1: 0, 2: 5, 3: 19, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!