ID: 952572264_952572270

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 952572264 952572270
Species Human (GRCh38) Human (GRCh38)
Location 3:34731725-34731747 3:34731753-34731775
Sequence CCATCATCACTGTGGCTGCCTGT AAGAAAACTGAGCTCCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 21, 3: 58, 4: 337} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!