ID: 952575356_952575363

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 952575356 952575363
Species Human (GRCh38) Human (GRCh38)
Location 3:34767929-34767951 3:34767953-34767975
Sequence CCATCTGCCCTTTGATAAACCTG CAGAAACAAGAAATGGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 289, 3: 6322, 4: 3959} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!