ID: 952611534_952611544

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 952611534 952611544
Species Human (GRCh38) Human (GRCh38)
Location 3:35216052-35216074 3:35216086-35216108
Sequence CCATGTCCTGCTTGGCCCGCTGC CAGCTCGGACAGCTTGGCGTTGG
Strand - +
Off-target summary {0: 13, 1: 9, 2: 21, 3: 34, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!