ID: 952662347_952662349

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 952662347 952662349
Species Human (GRCh38) Human (GRCh38)
Location 3:35866852-35866874 3:35866874-35866896
Sequence CCAAATAGATAACACAAAACAAA AGATGATCACAGTGTCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 105, 4: 1371} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!