ID: 952673666_952673674

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 952673666 952673674
Species Human (GRCh38) Human (GRCh38)
Location 3:36000751-36000773 3:36000788-36000810
Sequence CCACAGGTTGGAACAGCTGAGTC GGTGGTGGCCCTCCTTCCCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!