ID: 952738911_952738917

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 952738911 952738917
Species Human (GRCh38) Human (GRCh38)
Location 3:36716772-36716794 3:36716795-36716817
Sequence CCCCATACTCTCCTCACTCTGTA GAGAAGGGTGTGACTACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 281} {0: 1, 1: 0, 2: 1, 3: 23, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!