ID: 952744980_952744984

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 952744980 952744984
Species Human (GRCh38) Human (GRCh38)
Location 3:36768624-36768646 3:36768653-36768675
Sequence CCCCAGCTCTGCTCAATAATCAC TCCCTTTGGCCCCATTGTAATGG
Strand - +
Off-target summary No data {0: 6, 1: 4, 2: 0, 3: 14, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!