ID: 952762848_952762854

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 952762848 952762854
Species Human (GRCh38) Human (GRCh38)
Location 3:36930341-36930363 3:36930354-36930376
Sequence CCTGCCAACAACATGAGTGAGTC TGAGTGAGTCTGGAAGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 133} {0: 1, 1: 0, 2: 2, 3: 34, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!