ID: 952776767_952776772

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 952776767 952776772
Species Human (GRCh38) Human (GRCh38)
Location 3:37053907-37053929 3:37053950-37053972
Sequence CCAGGTGGCTGTTGGTCATCTCC TGCTGTTCGTAACTGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 196} {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!