ID: 952779996_952779997

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 952779996 952779997
Species Human (GRCh38) Human (GRCh38)
Location 3:37087148-37087170 3:37087174-37087196
Sequence CCACACACACTTTTAATAATGCT TAAACCAGAATTAAGTTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 229} {0: 1, 1: 0, 2: 2, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!