ID: 952786429_952786433

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 952786429 952786433
Species Human (GRCh38) Human (GRCh38)
Location 3:37160106-37160128 3:37160123-37160145
Sequence CCTATTCTCCAGGATACCAGAAG CAGAAGTTCTAGAAGACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144} {0: 1, 1: 0, 2: 1, 3: 39, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!