ID: 952820415_952820418

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 952820415 952820418
Species Human (GRCh38) Human (GRCh38)
Location 3:37481535-37481557 3:37481552-37481574
Sequence CCCCATGGCTTCTGCTACATCAT CATCATCCCCTCCAACCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 194} {0: 1, 1: 0, 2: 0, 3: 33, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!