ID: 952820415_952820421

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 952820415 952820421
Species Human (GRCh38) Human (GRCh38)
Location 3:37481535-37481557 3:37481559-37481581
Sequence CCCCATGGCTTCTGCTACATCAT CCCTCCAACCTCCAGGCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 194} {0: 1, 1: 0, 2: 1, 3: 29, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!