ID: 952827662_952827670

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 952827662 952827670
Species Human (GRCh38) Human (GRCh38)
Location 3:37537643-37537665 3:37537657-37537679
Sequence CCTCATGGAGCTGGCATTCTAGT CATTCTAGTGGGAGGGGGGCAGG
Strand - +
Off-target summary {0: 3, 1: 19, 2: 113, 3: 516, 4: 1622} {0: 1, 1: 0, 2: 2, 3: 34, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!