ID: 952832544_952832556

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 952832544 952832556
Species Human (GRCh38) Human (GRCh38)
Location 3:37577059-37577081 3:37577108-37577130
Sequence CCAGTCCTTGGGCTCTGTTCCTC CAGGGAAGACAGAAAGATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 298} {0: 1, 1: 0, 2: 7, 3: 120, 4: 1031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!