ID: 952844975_952844981

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 952844975 952844981
Species Human (GRCh38) Human (GRCh38)
Location 3:37680615-37680637 3:37680649-37680671
Sequence CCCCTCCTCCATGGTCCTGGGCT TCTCCCTGCCAAATATTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 395} {0: 1, 1: 0, 2: 1, 3: 23, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!