ID: 952854282_952854283

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 952854282 952854283
Species Human (GRCh38) Human (GRCh38)
Location 3:37755067-37755089 3:37755080-37755102
Sequence CCAAAAAAATGAATACCATTTAT TACCATTTATTGCTGTCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 690} {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!