ID: 952892679_952892692

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 952892679 952892692
Species Human (GRCh38) Human (GRCh38)
Location 3:38053661-38053683 3:38053697-38053719
Sequence CCCTCTGCCCAGCGGCCACCCCG CCCAACAGCTCATTGAGAACGGG
Strand - +
Off-target summary {0: 1, 1: 53, 2: 535, 3: 1705, 4: 2025} {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!