ID: 952922231_952922235

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 952922231 952922235
Species Human (GRCh38) Human (GRCh38)
Location 3:38293433-38293455 3:38293456-38293478
Sequence CCAAGTTCAATAGGGTTTTTAAG TTTTGCTCCGGGCCTAAGGCAGG
Strand - +
Off-target summary {0: 3, 1: 57, 2: 47, 3: 17, 4: 170} {0: 2, 1: 0, 2: 0, 3: 10, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!