ID: 952934591_952934599

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 952934591 952934599
Species Human (GRCh38) Human (GRCh38)
Location 3:38386290-38386312 3:38386340-38386362
Sequence CCCTTGAGCCACTTCTGTTTGCC AAGAAAAAAGAAAGGTAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 207} {0: 2, 1: 46, 2: 506, 3: 4143, 4: 19792}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!