ID: 952942269_952942282

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 952942269 952942282
Species Human (GRCh38) Human (GRCh38)
Location 3:38454014-38454036 3:38454052-38454074
Sequence CCCCGCCGCGCTATGCCTGAGTC CGTGCCCCGCCGCCGCCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44} {0: 1, 1: 1, 2: 7, 3: 62, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!