ID: 952950879_952950882

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 952950879 952950882
Species Human (GRCh38) Human (GRCh38)
Location 3:38524050-38524072 3:38524063-38524085
Sequence CCAAGTGAGCCTCCAGGACCTAG CAGGACCTAGAGAAGTTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 142} {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!