ID: 952965043_952965049

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 952965043 952965049
Species Human (GRCh38) Human (GRCh38)
Location 3:38615939-38615961 3:38615969-38615991
Sequence CCGGGTGTGGCTAAGGACAGCAG TGCCTAGGATACTGGTTTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 182} {0: 1, 1: 0, 2: 0, 3: 9, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!