ID: 952971521_952971535

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 952971521 952971535
Species Human (GRCh38) Human (GRCh38)
Location 3:38653802-38653824 3:38653855-38653877
Sequence CCCAGCCCTCCCCAGCAGAGGCT AGCTCTAGATGGAGGGCATCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!