ID: 952985966_952985967

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 952985966 952985967
Species Human (GRCh38) Human (GRCh38)
Location 3:38783628-38783650 3:38783662-38783684
Sequence CCGGTTTGGGGTTTTTATGGGCA ACTTTCTTGTAGCTGTAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 224} {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!