ID: 953023889_953023901

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 953023889 953023901
Species Human (GRCh38) Human (GRCh38)
Location 3:39133884-39133906 3:39133928-39133950
Sequence CCTGCATGGGGATACAGGGCACC CCCAGAGTCTGGGGCACAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 141} {0: 1, 1: 3, 2: 1, 3: 43, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!