ID: 953032078_953032094

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 953032078 953032094
Species Human (GRCh38) Human (GRCh38)
Location 3:39185832-39185854 3:39185872-39185894
Sequence CCCCAGGCCATCTGTGTGCAGCC CTGGCCCAGTACTCTGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 269} {0: 1, 1: 0, 2: 2, 3: 22, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!