ID: 953032767_953032774

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 953032767 953032774
Species Human (GRCh38) Human (GRCh38)
Location 3:39188950-39188972 3:39188988-39189010
Sequence CCAGTGGCTTTGTCTCAAATAGC ACGTCTCCTCCACCTGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 262} {0: 1, 1: 0, 2: 0, 3: 10, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!