ID: 953044122_953044129

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 953044122 953044129
Species Human (GRCh38) Human (GRCh38)
Location 3:39280372-39280394 3:39280392-39280414
Sequence CCCACGAGAGGGAGCCCAGAGTA GTACTCACTGGACCACACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 137} {0: 1, 1: 0, 2: 1, 3: 12, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!