ID: 953100487_953100493

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 953100487 953100493
Species Human (GRCh38) Human (GRCh38)
Location 3:39820931-39820953 3:39820960-39820982
Sequence CCATCCACTTTCTGCTTGGGTTG CCTCAGGCTGCTGCTGATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 297} {0: 1, 1: 1, 2: 6, 3: 52, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!