ID: 953129368_953129371

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 953129368 953129371
Species Human (GRCh38) Human (GRCh38)
Location 3:40123742-40123764 3:40123758-40123780
Sequence CCTGTAGCTAAGGGACCCTGAGA CCTGAGAAGCAGCTCATCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 37, 4: 128} {0: 1, 1: 0, 2: 5, 3: 16, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!