|
Left Crispr |
Right Crispr |
| Crispr ID |
953132038 |
953132044 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:40149376-40149398
|
3:40149391-40149413
|
| Sequence |
CCAAACACCTTCCACCAGGCCCA |
CAGGCCCACCTCTAGCATTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 95, 2: 923, 3: 2992, 4: 5617} |
{0: 1, 1: 5, 2: 26, 3: 135, 4: 627} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|